A species-specific PCR based assay for rapid detection of mango anthracnose pathogen Colletotrichum gloeosporioides Penz. and Sacc.
Kamle M., Pandey B. K., Kumar P., Kumar M. M.
Author Affiliation: Division of Crop Protection, Plant Molecular Pathology Lab, Central Institute for Subtropical Horticulture, Rehmankhera, Lucknow, India.
Journal of Plant Pathology and Microbiology 4 :184
Abstract : Mango (Mangifera indica L.) a fruit of nutraceutical value is accepted as the most eatable fruit crop worldwide. Mango production has been severely affected by several biotic stress mainly diseases and anthracnose is the major post-harvest disease of mango results in heavy losses. The present investigation describes PCR based assay for rapid and sensitive detection of Colletotrichum gloeosporioides causing mango anthracnose. Genus specific universal primer pair ITS1 and ITS4 was employed to amplify Colletotrichum genus which shows ~560 bp amplicon. The Colletotrichum gloeosporioides species-specific sequences for conserved domains were retrieved from the NCBI Genbank (sequence HM10205) and specific primers were designed. In order to validate the species-specific designed primer, a sensitive nested PCR assay was carried out using designed primer-pair MKCgF 5? TTGCTTCGGCGGGTAGGGTC 3? (forward) and MKCgR 3?ACGCAAAGGAGGCTCCGGGA 5? (reverse) produced an amplicon size of 380 bp as specific. Our investigation revealed that C. gloeosporioides causal agent of mango anthracnose was discriminated on the basis of species as specific for mango in comparison to other Colletotrichum spp. viz. C. acutatum, C. falcatum and C. capsici causing anthracnose in other crops.